

K-ras Gene Mutations
ATGACTGAATATAAACTTGTGGTAGTTGGAGCTCGTGGCGTAGGCAAGAGTGCCTTGACG
ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGATGGCGTAGGCAAGAGTGCCTTGACG
ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGTTGGCGTAGGCAAGAGTGCCTTGACG
ATGACTGAATATAAACTTGTGGTAGTTGGAGCTTGTGGCGTAGGCAAGAGTGCCTTGACG
ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGACGTAGGCAAGAGTGCCTTGACG
K-ras mutations are believed to be the “early genetic event” in the development of pancreatic neoplasia because they occur in the pancreatic duct lesion with minimal abnormality in cells. Although K-ras mutations are uncommon in the precancerous stage, over 90% of pancreatic carcinomas have them. Analysis of research within the last decade on the mutations in human pancreatic adenocarcinoma indicates a key point that there is a specific profile of genetic and molecular alterations that distinguishes pancreatic cancer from other cancers.
There are 4 significant K-ras point mutations (substitution) associated with pancreatic cancer. Additionally we have identified another substitution point mutation that occurs extremely low in frequency in pancreatic cancer.
We are exploring the significance of each of the four mutations for our target selection as well as their combinations while using the “low frequency point mutation sequence” as the negative control to increase the specificity for pancreatic cancer detection.
LI100 LIVER CANCER (HEPATOCELLULAR CARCINOMA)
CTNNB1 Gene Mutations
ACCACAGCTCCTCCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTC
GCCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTC ACCACAGCTCCTTTTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTC
GCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTGTGGAATCCATTCTGGTGCCAC
Hepatocellular adenomas (benign tumors) with the CTNNB1 mutation may have a higher risk of malignant transformation. Although many other types of cancers possess CTNNB1 mutations, there are mutations which may occur exclusively or predominantly in HCC. Four such mutations associated with hepatocellular carcinoma (HCC) have been identified by NanoIVD.

The most common form of liver cancer in adults is hepatocellular carcinoma (HCC) which begins in the hepatocytes and makes up 75% of primary liver cancers. HCC most commonly appears in a patient with chronic viral hepatitis (hepatitis B or hepatitis C, combined making up 20%) or with cirrhosis (about 80%).